Encomenda rápida

Ratazanao CD39 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse ENTPD1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1533bp
Descrição de cDNA:Full length Clone DNA of Mus musculus ectonucleoside triphosphate diphosphohydrolase 1 with C terminal Flag tag.
Sinónimo de gene:Cd39, AA408691, NTPDase-1, 2610206B08Rik, Entpd1
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

CD39, also known as ENTPD1, belongs to the GDA1/CD39 NTPase family. It is expressed primarily on activated lymphoid cells and can also be detected in endothelial tissues. The vascular isoform and the placental isoform II are present in both placenta and umbilical vein, whereas placental isoform I is present in placenta only. CD39 can hydrolyze both nucleoside triphosphates and diphosphates. It is the dominant ecto nucleotidase of vascular and placental trophoblastic tissues and appears to modulate the functional expression of type 2 purinergic (P2) G protein coupled receptors (GPCRs). CD39 transgenic mice exhibit impaired platelet aggregation, prolonged bleeding times, and resistance to systemic thromboembolism. There is a correlation between ATP hydrolysis and triglycerides in patients with chronic heart disease, suggesting a relationship between ATP diphosphohydrolase and thrombogenesis. In the nervous system, CD39 could hydrolyze ATP and other nucleotides to regulate purinergic neurotransmission.

  • Kunzli BM, et al. (2011) Variable impact of CD39 in experimental murine colitis. Dig Dis Sci. 2011 56 (5): 1393-403.
  • Clayton A, et al. (2011) Cancer exosomes express CD39 and CD73, which suppress T cells through adenosine production. J Immunol. 187 (2): 676-83.
  • Loza MJ, et al. (2011) T-cell specific defect in expression of the NTPDase CD39 as a biomarker for lupus. Cell Immunol. 271 (1): 110-7.
  • Size / Price
    Catálogo: MG50398-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.