After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse ENG Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001146348.1
Tamanho de cDNA:1959bp
Descrição de cDNA:Full length Clone DNA of Mus musculus endoglin, transcript variant 3 with C terminal Flag tag.
Sinónimo de gene:CD105, AI528660, AI662476, S-endoglin, Eng
Espécie:Mouse
Vetor:pCMV3-C-FLAG
Plasmid:pCMV3-mENG-Flag
Local de restrição:KpnI + XbaI (6kb + 2kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ENG Gene Plasmid Map
Mouse ENG transcript variant 3 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50407-ACG$245
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50407-ACR$245
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50407-CF$215
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50407-CH$215
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50407-CM$215
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50407-CY$215
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50407-M$75
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50407-NF$215
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50407-NH$215
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50407-NM$215
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50407-NY$215
Ratazanao Endoglin/CD105 transcript variant 3 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50407-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type I I receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.

Size / Price
Catálogo: MG50407-CF
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
  • Mouse ENG transcript variant 3 natural ORF mammalian expression plasmid, C-Flag tag
  • Human SH2D1B ORF mammalian expression plasmid, C-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"