After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse ELANE Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_015779.2
Tamanho de cDNA:798bp
Descrição de cDNA:Full length Clone DNA of Mus musculus elastase, neutrophil expressed with N terminal Myc tag.
Sinónimo de gene:NE, F430011M15Rik, Ela2
Espécie:Mouse
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50204-ACG$225
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50204-ACR$225
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50204-ANG$225
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50204-ANR$225
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50204-CF$195
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50204-CH$195
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50204-CM$195
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50204-CY$195
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de expressão)MG50204-M$75
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50204-NF$195
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50204-NH$195
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50204-NM$195
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50204-NY$195
Ratazanao ELA2/Neutrophil Elastase clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50204-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Mouse Neutrophil elastase, also known as Elastase-2, Bone marrow serine protease, Medullasin, ELANE, and ELA2, is a serine proteinase in the same family as chymotrypsin and has broad substrate specificity. Secreted by neutrophils during inflammation, it destroys bacteria and host tissue. As with other serine proteinases, ELANE / ELA2 contains a charge relay system composed of the catalytic triad of histidine, aspartate, and serine residues that are dispersed throughout the primary sequence of the polypeptide but that are brought together in the three dimension conformation of the folded protein. ELANE / ELA2 is an important protease enzyme that when expressed aberrantly can cause emphysema or emphysematous changes. This involves breakdown of the lung structure and increased airspaces. Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. ELANE / ELA2 hydrolyzes proteins within specialized neutrophil lysosomes, called azurophil granules, as well as proteins of the extracellular matrix following the protein's release from activated neutrophils. ELANE / ELA2 may play a role in degenerative and inflammatory diseases by its proteolysis of collagen-IV and elastin of the extracellular matrix. ELANE / ELA2 degrades the outer membrane protein A (OmpA) of E. coli as well as the virulence factors of such bacteria as Shigella, Salmonella and Yersinia. Defects in ELANE are a cause of cyclic haematopoiesis (CH), also known as cyclic neutropenia. CH is an autosomal dominant disease in which blood-cell production from the bone marrow oscillates with 21-day periodicity. Defects in ELANE are also the cause of autosomal dominant severe congenital neutropenia type 1 (SCN1) which is a heterogeneous disorder of hematopoiesis.

Size / Price
Catálogo: MG50204-NM
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"