After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse EIF4EBP1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_007918.3
Tamanho de cDNA:354bp
Descrição de cDNA:Full length Clone DNA of Mus musculus Eukaryotic translation initiation factor 4E-binding protein 1 with N terminal His tag.
Sinónimo de gene:4e-bp1, PHAS-I
Espécie:Mouse
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50739-ACG$225
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50739-ACR$225
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50739-ANG$225
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50739-ANR$225
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50739-CF$195
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50739-CH$195
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50739-CM$195
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50739-CY$195
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50739-G$75
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50739-NF$195
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50739-NH$195
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50739-NM$195
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50739-NY$195
Ratazanao 4E-BP1/EIF4EBP1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50739-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The translational suppressor eIF4E binding protein-1, 4E-BP1 functions as a key regulator in cellular growth, differentiation, apoptosis and survival. The Eif4ebp1 gene, encoding 4E-BP1, is a direct target of a transcription factor activating transcription factor-4 (ATF4), a master regulator of gene expression in stress responses. 4E-BP1 is characterized by its capacity to bind specifically to eIF4E and inhibit its interaction with eIF4G. Phosphorylation of 4E-BP1 regulates eIF4E availability, and therefore, cap-dependent translation, in cell stress. Binding of eIF4E to eIF4G is inhibited in a competitive manner by 4E-BP1. Phosphorylation of 4E-BP1 decreases the affinity of this protein for eIF4E, thus favouring the binding of eIF4G and enhancing translation. 4E-BP1 is important for beta-cell survival under endoplasmic reticulum (ER) stress. 4E-BP1 mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways. Recently, 4E-BP1 was found to be a key factor, which converges several oncogenic signals, phosphorylates the molecules, and drives the downstream proliferative signals. Recent studies showed that high expression of phosphorylated 4E-BP-1 (p-4E-BP1) is associated with poor prognosis, tumor progression, or nodal metastasis in different human cancers.

Referências
  • Azar R, et al. (2008) Phosphatidylinositol 3-kinase-dependent transcriptional silencing of the translational repressor 4E-BP1. Cell Mol Life Sci. 65(19): 3110-7.
  • Tominaga R, et al. (2010) The JNK pathway modulates expression and phosphorylation of 4E-BP1 in MIN6 pancreatic beta-cells under oxidative stress conditions. Cell Biochem Funct. 28(5): 387-93.
  • Ayuso MI, et al. (2010) New hierarchical phosphorylation pathway of the translational repressor eIF4E-binding protein 1 (4E-BP1) in ischemia-reperfusion stress. J Biol Chem. 285(45): 34355-63.
  • Size / Price
    Catálogo: MG50739-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"