Encomenda rápida

Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato AGO2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2583bp
Descrição de cDNA:Full length Clone DNA of Mus musculus eukaryotic translation initiation factor 2C, 2 with C terminal Myc tag.
Sinónimo de gene:Ago2, Gerp95, Gm10365, KIAA4215, mKIAA4215, ENSMUSG00000072493, Eif2c2
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
( We provide with AGO2 qPCR primers for gene expression analysis, MP200661 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50683-ACG$325
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50683-ACR$325
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50683-ANG$325
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50683-ANR$325
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50683-CF$295
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50683-CH$295
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50683-CM$295
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50683-CY$295
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50683-M$75
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50683-NF$295
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50683-NH$295
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50683-NM$295
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50683-NY$295
Ratazanao AGO2/Argonaute 2/EIF2C2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50683-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name

Argonaute 2 (AGO2), also known as Eukaryotic translation initiation factor 2C2 (EIF2C2), belongs to the Argonaute family, AGO subfamily, which is a component of the RNA-induced silencing complex (RISC) and mediates small interfering RNA (siRNA)-directed mRNA cleavage and microRNA translational suppression. AGO2 protein is the catalytic engine of mammalian RNAi. It contains a PIWI domain that is structurally related to RNases H and possibly shares with them a two-metal-ion catalysis mechanism. Human AGO2 was unable to cleave preformed RNA duplexes and exhibited weaker binding affinity for RNA duplexes compared with the single strand RNA. The enzyme exhibited greater RNase H activity in the presence of Mn2+ compared with Mg2+. Human AGO2 exhibited weaker binding affinities and reduced cleavage activities for antisense RNAs with either a 5'-terminal hydroxyl or abasic nucleotide. In mouse hematopoiesis, AGO2 controls early development of lymphoid and erythroid cells. AGO2 is a highly specialized member of the Argonaute family with an essential nonredundant Slicer-independent function within the mammalian miRNA pathway. AGO2 regulates dFMR1 expression, and the relationship between dFMR1 and AGO2 was defined by their physical interaction and co-regulation of downstream targets. AGO2 and dFMR1 are also connected through a regulatory relationship. AGO2 is a regulator of dFMR1 expression and have clarified an important developmental role for AGO2 in the nervous system and germ line that requires dFMR1 function. In addition, AGO2 is regulated at both the transcriptional and posttranslational level, and also implicate AGO2 and enhanced micro-RNA activity in the tumorigenic progression of breast cancer cell lines.

  • O'Carroll D, et al. (2007) A Slicer-independent role for Argonaute 2 in hematopoiesis and the microRNA pathway. Genes Dev. 21(16): 1999-2004.
  • Pepper AS, et al. (2009) Argonaute2 suppresses Drosophila fragile X expression preventing neurogenesis and oogenesis defects. PLoS One. 4(10): e7618.
  • Lima WF, et al. (2009) Binding and cleavage specificities of human Argonaute2. J Biol Chem. 284(38): 26017-28.
  • Adams BD, et al. (2009) Argonaute-2 expression is regulated by epidermal growth factor receptor and mitogen-activated protein kinase signaling and correlates with a transformed phenotype in breast cancer cells. Endocrinology. 150(1): 14-23.
  • Salvatore V, et al. (2010) Bacterial expression of mouse argonaute 2 for functional and mutational studies. Int J Mol Sci. 11(2): 745-53.
  • Wilson JA, et al. (2011) Human Ago2 is required for efficient microRNA 122 regulation of hepatitis C virus RNA accumulation and translation. J Virol. 85(5): 2342-50.
  • Size / Price
    Catálogo: MG50683-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.