After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao VE-statin/EGFL7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse EGFL7 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_178444.3
Tamanho de cDNA:825bp
Descrição de cDNA:Full length Clone DNA of Mus musculus EGF-like domain 7 with C terminal His tag.
Sinónimo de gene:Zneu1, VE-statin, Egfl7
Espécie:Mouse
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao VE-statin/EGFL7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Product nameProduct name
Fundo

Epidermal growth factor-like protein 7, also known as EGF-like protein 7, Multiple epidermal growth factor-like domains protein 7, Multiple EGF-like domains protein 7, Vascular endothelial statin, NOTCH4-like protein and EGFL7, is a secreted protein which contains two EGF-like domains and one EMI domain. EGFL7 was identified by a number of groups as a putative secreted factor produced by the vascular endothelial cells (ECs). EGFL7 is described as a novel endothelial cell-derived factor involved in the regulation of the spatial arrangement of cells during vascular tube assembly. With its impact on tubulogenesis and vessel shape EGFL7 joined the large family of molecules governing blood vessel formation. EGFL7 regulates midline angioblast migration in zebrafish embryos-a key step in vascular tubulogenesis. EGFL7 is tightly associated with the extracellular matrix (ECM), and it supports EC migration either as a single factor or in combination with other ECM molecules. EGFL7 provides a proper microenvironment for endothelial cell migration, thereby enabling accurate patterning. Our study indicates that the molecular composition of the ECM influences vascular morphogenesis. EGFL7 also regulates vascular tubulogenesis. It inhibits platelet-derived growth factor (PDGF)-BB-induced smooth muscle cell migration and promotes endothelial cells adhesion to the substrate.

Referências
  • Fitch,M.J. et al., 2004, Dev Dyn. 230 (2):316-24.
  • Schmidt,M. et al., 2007, Novartis Found Symp. 283 :18-28.
  • Campagnolo,L.et al., 2008, Gene Expr Patterns  8 (6):389-96.
  • Picuric,S. et al., 2009, Protein Expr Purif. 68 (1):1-6.
  • Nikolic,I. et al., 2010, J Angiogenes Res. 2 (1): 9. 
  • Size / Price
    Catálogo: MG50472-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"