Encomenda rápida

Text Size:AAA

Mouse Desmocollin-2 ORF mammalian expression plasmid, C-Flag tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse DSC2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2691bp
Descrição de cDNA:Full length Clone DNA of Mus musculus desmocollin 3 with C terminal Flag tag.
Sinónimo de gene:Dsc3
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

DSC2 is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily. Like other desmocollins, murine DSC2 has two products, Dsc2a and Dsc2b, produced by alternative splicing of a 46 bp exon which encodes 11 COOH-terminal aa followed by an in-frame stop codon. These desmosomal family members, along with the desmogleins, are found primarily in epithelial cells where they constitute the adhesive proteins of the desmosome cell-cell junction and are required for cell adhesion and desmosome formation. The desmosomal family members are arranged in two clusters on chromosome 18, occupying less than 650 kb combined. Mutations in DSC2 are associated with arrhythmogenic right ventricular dysplasia-11. DSC2 is Involved in the interaction of plaque proteins and intermediate filaments mediating cell-cell adhesion. DSC2 may contribute to epidermal cell positioning by mediating differential adhesiveness between cells that express different isoforms.

  • Nuber UA, et al. (1995) The widespread human desmocollin Dsc2 and tissue-specific patterns of synthesis of various desmocollin subtypes. Eur J Cell Biol. 66 (1): 69-74.
  • Marsden MD, et al. (1997) Cloning and transcriptional analysis of the promoter of the human type 2 desmocollin gene (DSC2). Gene. 186 (2): 237-47.
  • Greenwood MD, et al. (1997) Exon-intron organization of the human type 2 desmocollin gene (DSC2): desmocollin gene structure is closer to "classical" cadherins than to desmogleins. Genomics. 44 (3): 330-5.
  • Size / Price
    Catálogo: MG50401-CF
    Preço de catálogo:   (Save )
    Preço:      [How to order]
    Disponibilidade2-3 weeksInstruções de envio
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.