Encomenda rápida

Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato DYNC1I1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_010063.4
Tamanho de cDNA:1887bp
Descrição de cDNA:Full length Clone DNA of Mus musculus dynein cytoplasmic 1 intermediate chain 1.
Sinónimo de gene:DIC, IC74, DHIC-1, Dncic1, DH IC-1
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with DYNC1I1 qPCR primers for gene expression analysis, MP201245 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51372-ACG$245
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51372-ACR$245
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51372-ANG$245
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51372-ANR$245
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51372-CF$215
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51372-CH$215
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51372-CM$215
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51372-CY$215
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51372-NF$215
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51372-NH$215
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51372-NM$215
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51372-NY$215
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51372-U$75
Ratazanao Dynein intermediate chain 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51372-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51372-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"