Encomenda rápida

Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato DHRS1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_026819.3
Tamanho de cDNA:942bp
Descrição de cDNA:Full length Clone DNA of Mus musculus dehydrogenase/reductase (SDR family) member 1 with C terminal His tag.
Sinónimo de gene:AW112170; D14Ertd484e; 1110029G07Rik
Espécie:Mouse
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with DHRS1 qPCR primers for gene expression analysis, MP202157 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52284-ACG$225
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52284-ACR$225
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52284-ANG$225
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52284-ANR$225
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52284-CF$195
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52284-CH$195
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52284-CM$195
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52284-CY$195
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52284-G$75
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52284-NF$195
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52284-NH$195
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52284-NM$195
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52284-NY$195
Ratazanao DHRS1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52284-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52284-CH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Acrescentar a carrinhoBulk Discount Requiry
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"