Encomenda rápida

Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse DHCR24 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1551 bp
Descrição de cDNA:Full length Clone DNA of Mus musculus 24-dehydrocholesterol reductase
Sinónimo de gene:2310076D10Rik,5830417J06Rik,mKIAA0018
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51733-ACG$245
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51733-ACR$245
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51733-ANG$245
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51733-ANR$245
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51733-CF$75
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51733-CH$215
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51733-CM$215
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51733-CY$215
Mouse DHCR24 Gene cDNA clone plasmidMG51733-G$75
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51733-NF$215
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51733-NH$215
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51733-NM$215
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51733-NY$215
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51733-U$75
Ratazanao Seladin 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51733-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51733-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.