After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse DDC Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001190448.1
Tamanho de cDNA:1443bp
Descrição de cDNA:Full length Clone DNA of Mus musculus dopa decarboxylase with N terminal Myc tag.
Sinónimo de gene:Aadc, Ddc
Espécie:Mouse
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50799-ACG$225
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50799-ACR$225
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50799-ANG$225
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50799-ANR$225
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50799-CF$195
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50799-CH$195
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50799-CM$195
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50799-CY$195
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de expressão)MG50799-G$75
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50799-NF$195
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50799-NH$195
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50799-NM$195
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50799-NY$195
Ratazanao DOPA Decarboxylase/DDC clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50799-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

Referências
  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.
  • Size / Price
    Catálogo: MG50799-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"