After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse DCTN4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:AK034292.1
Tamanho de cDNA:1404bp
Descrição de cDNA:Full length Clone DNA of Mus musculus dynactin 4.
Sinónimo de gene:p62, 1110001K06Rik, 4930547K17Rik, C130039E17Rik
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51373-ACG$225
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51373-ACR$225
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51373-ANG$225
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51373-ANR$225
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51373-CF$195
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51373-CH$195
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51373-CM$195
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51373-CY$195
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51373-NF$195
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51373-NH$195
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51373-NM$195
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51373-NY$195
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51373-U$75
Ratazanao DCTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51373-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51373-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"