Encomenda rápida

Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato DAP3 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_022994.3
    Tamanho de cDNA:1191bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus death associated protein 3 with N terminal His tag.
    Sinónimo de gene:DAP-3; S29mt; MRP-S29; 4921514D13Rik
    Espécie:Mouse
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DAP3 qPCR primers for gene expression analysis, MP201291 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51407-ACG$225
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51407-ACR$225
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51407-ANG$225
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51407-ANR$225
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51407-CF$195
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51407-CH$195
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51407-CM$195
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51407-CY$195
    Mouse DAP3 Gene cDNA clone plasmidMG51407-G$75
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51407-NF$195
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51407-NH$195
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51407-NM$195
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51407-NY$195
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51407-U$75
    Ratazanao DAP3 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51407-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG51407-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"