Encomenda rápida

Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato D6WSU163E Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_138594.3
Tamanho de cDNA:1659bp
Descrição de cDNA:Full length Clone DNA of Mus musculus DNA segment, Chr 6, Wayne State University 163, expressed.
Sinónimo de gene:C12orf4
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with D6WSU163E qPCR primers for gene expression analysis, MP202327 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52454-ACG$245
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52454-ACR$245
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52454-ANG$245
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52454-ANR$245
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52454-CF$215
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52454-CH$215
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52454-CM$215
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52454-CY$215
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de expressão)MG52454-G$75
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52454-NF$215
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52454-NH$215
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52454-NM$215
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52454-NY$215
Ratazanao D6WSU163E clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52454-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52454-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"