After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CYP7B1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_007825.4
Tamanho de cDNA:1524bp
Descrição de cDNA:Full length Clone DNA of Mus musculus cytochrome P450, family 7, subfamily b, polypeptide 1.
Sinónimo de gene:hct-1, AW261589, D3Ertd552e
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52457-ACG$245
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52457-ACR$245
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52457-ANG$245
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52457-ANR$245
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52457-CF$215
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52457-CH$215
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52457-CM$215
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52457-CY$215
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52457-G$75
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52457-NF$215
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52457-NH$215
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52457-NM$215
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52457-NY$215
Ratazanao CYP7B1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52457-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52457-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"