Encomenda rápida

Ratazanao Cathepsin D/CTSD clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CTSD Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1233bp
Descrição de cDNA:Full length Clone DNA of Mus musculus cathepsin D with N terminal His tag.
Sinónimo de gene:CD, CatD, Ctsd
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao Cathepsin D/CTSD clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Product nameProduct name

Cathepsin D (CTSD), a well known lysosomal aspartyl protease and belongs to the peptidase C1 family, which is a normal and major component of lysosomes, and is found in almost all cells and tissues of mammals. Its mostly described function is intracellular catabolism in lysosomal compartments, other physiological effect include hormone and antigen processing. Cathepsin D has a specificity similar to but narrower than that of pepsin A. Cathepsin D plays an important role in the degradation of proteins, the generation of bioactive proteins, antigen processing, etc. Among different role in cell physiology, a new function of this enzyme is examined. Cathepsin D is an important regulator of apoptotic pathways in cells. It acts at different stage of intrinsic and extrinsic pathway of apoptosis. In addition, CTSD secreted from human prostate carcinoma cells are responsible for the generation of angiostatin, a potent endogenous inhibitor of angiogenesis, suggesting its contribution to the prevention of tumor growth and angiogenesis-dependent growth of metastases.

  • Fusek M, et al. (2005) Dual role of cathepsin D: ligand and protease. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 149(1): 43-50.
  • Minarowska A, et al. (2007) Regulatory role of cathepsin D in apoptosis. Folia Histochem Cytobiol. 45(3): 159-63.
  • Zaidi N, et al. (2008) Cathepsin D: a cellular roadmap. Biochem Biophys Res Commun. 376(1): 5-9.
  • Size / Price
    Catálogo: MG50127-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.