After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CS Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_026444.3
Tamanho de cDNA:1395bp
Descrição de cDNA:Full length Clone DNA of Mus musculus citrate synthase with N terminal His tag.
Sinónimo de gene:Cis; ahl4; BB234005; 2610511A05Rik; 9030605P22Rik
Espécie:Mouse
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52549-ACG$225
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52549-ACR$225
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52549-ANG$225
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52549-ANR$225
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52549-CF$195
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52549-CH$195
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52549-CM$195
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52549-CY$195
Mouse CS Gene cDNA clone plasmidMG52549-G$95
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52549-NF$195
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52549-NH$195
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52549-NM$195
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52549-NY$195
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de expressão)MG52549-U$75
Ratazanao citrate synthase / CS clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52549-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52549-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"