After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CRP Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_007768.4
Tamanho de cDNA:678bp
Descrição de cDNA:Full length Clone DNA of Mus musculus C-reactive protein, pentraxin-related with C terminal Flag tag.
Sinónimo de gene:AI255847, Crp
Espécie:Mouse
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50409-ACG$225
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50409-ACR$225
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50409-CF$195
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50409-CH$195
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50409-CM$195
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50409-CY$195
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de expressão)MG50409-M$75
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50409-NF$195
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50409-NH$195
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50409-NM$195
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50409-NY$195
Ratazanao C-Reactive Proteína/CRP clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50409-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

C-reactive protein (CRP) is synthesized by the liver in response to factors released by fat cells. It is a member of the pentraxin family of proteins. The levels of CRP rise in response to inflammation. Human C-reactive protein (CRP) is the classical acute phase reactant, the circulating concentration of which rises rapidly and extensively in a cytokine-mediated response to tissue injury, infection and inflammation. Serum CRP values are routinely measured, empirically, to detect and monitor many human diseases. However, CRP is likely to have important host defence, scavenging and metabolic functions through its capacity for calcium-dependent binding to exogenous and autologous molecules containing phosphocholine (PC) and then activating the classical complement pathway. CRP may also have pathogenic effects and the recent discovery of a prognostic association between increased CRP production and coronary atherothrombotic events is of particular interest.

Referências
  • Pepys MB. et al., 2003, J Clin Invest. 111 (12): 1805-12.
  • Thompson D. et al., 1999, Structure. 7(2): 169-77.
  • Size / Price
    Catálogo: MG50409-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"