Encomenda rápida

Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato CRABP2 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:417bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus cellular retinoic acid binding protein II with N terminal HA tag.
    Sinónimo de gene:Crabp-2, CrabpII, AI893628, Crabp2
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    ( We provide with CRABP2 qPCR primers for gene expression analysis, MP200527 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50535-ACG$225
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50535-ACR$225
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50535-ANG$225
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50535-ANR$225
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50535-CF$195
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50535-CH$195
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50535-CM$195
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50535-CY$195
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50535-M$75
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50535-NF$195
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50535-NH$195
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50535-NM$195
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50535-NY$195
    Ratazanao CRABP2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50535-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name

    Cellular retinoic acid-binding protein 2, also known as Cellular retinoic acid-binding protein II, CRABP-II and CRABP2, is a protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. Cellular retinoic acid binding proteins (CRABP) are low molecular weight proteins whose precise function remains unknown. The predicted amino acid sequences of human CRABP1 and CRABP2 demonstrated a 99.3% and 93.5% identity to mouse CRABP1 and CRABP2, respectively. CRABP2 forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. Expression of CRABP2, but not CRABP1 mRNA, was markedly increased (greater than 15-fold) by retinoic acid treatment of fibroblasts cultured from human skin, whereas no significant induction of CRABP2 mRNA was observed in human lung fibroblasts. CRABP2 transports retinoic acid to the nucleus. It regulates the access of retinoic acid to the nuclear retinoic acid receptors. CRABP2 is necessary for elastin induction by All-trans retinoic acid (ATRA) in MRC-5 cells. It is expressed at low levels in emphysema fibroblasts. This alteration in the retinoic acid signalling pathway in lung fibroblasts may contribute to the defect of alveolar repair in human pulmonary emphysema.

  • Deak,KL.et al., 2005,Birth Defects Res A Clin Mol Teratol.73 (11): 868-75.
  • Plantier, L. et al., 2008, Thorax  63 (11): 1012-7.
  • Calmon, M.F. et al., 2009, Neoplasia  11 (12): 1329-39.
  • Welch, I.D. et al., 2009, Arthritis Res Ther  11 (1): R14.
  • Size / Price
    Catálogo: MG50535-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.