Encomenda rápida

Text Size:AAA

Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CPE Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1431bp
Descrição de cDNA:Full length Clone DNA of Mus musculus carboxypeptidase E with N terminal Flag tag.
Sinónimo de gene:CPH; fat; Cph1; Cph-1; R74677
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51055-ACG$225
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51055-ACR$225
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51055-ANG$225
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51055-ANR$225
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51055-CF$75
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51055-CH$195
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51055-CM$195
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51055-CY$195
Mouse CPE Gene cDNA clone plasmidMG51055-G$75
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51055-NF$195
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51055-NH$195
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51055-NM$195
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51055-NY$195
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de expressão)MG51055-U$75
Ratazanao Carboxypeptidase E/CPE clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51055-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Human carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase, and the conversion of proCPE into CPE occurs primarily in secretory vesicles. The active form of CPE cleaves C-terminal amino acid residues of the peptide, and is thus involved in the biosynthesis of peptide hormones and neurotransmitters including insulin, enkephalin, etc. The enzymatic activity is enhanced by millimolar concentrations of Co2+. It has also been proposed that membrane-associated carboxypeptidase E acts as a sorting receptor for targeting regulated secretory proteins which are mostly prohormones and neuropeptides in the trans-Golgi network of the pituitary and in secretory granules into the secretory pathway.Its interaction with glycosphingolipid-cholesterol rafts at the TGN facilitates the targeting. Mutations in this gene are implicated in type I I diabetes due to impaired glucose clearance and insulin resistance.

  • Manser, E. et al., 1990, Biochem. J. 267: 517-525.
  • Cool, D.R. et al., 1997, Cell. 88: 73-83.
  • Song, L. and Fricker, L. 1995, J. Neurochem. 65: 444-453.
  • Dhanvantari,S. et al., 2000, J. Biol. Chem. 275: 29887-29893.
  • Jeffrey, K.D. et al., 2008, Proc. Natl. Acad. Sci. U.S.A. 105: 8452-8457
  • Size / Price
    Catálogo: MG51055-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.