After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CPB1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_029706.1
Tamanho de cDNA:1248bp
Descrição de cDNA:Full length Clone DNA of Mus musculus carboxypeptidase B1 (tissue) with C terminal Myc tag.
Sinónimo de gene:AI504870, 0910001A18Rik, 1810063F02Rik, 2210008M23Rik, Cpb1
Espécie:Mouse
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50386-ACG$225
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50386-ACR$225
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50386-CF$195
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50386-CH$195
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50386-CM$195
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50386-CY$195
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50386-M$75
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50386-NF$195
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50386-NH$195
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50386-NM$195
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50386-NY$195
Ratazanao Carboxypeptidase B1/CPB1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50386-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Human Carboxypeptidase B1, also well known as pancreatic procarboxypeptidase B (PCPB), is a highly pancreas -specific protein (PASP), and has been identified previously as a serum marker for acute pancreatitis and pancreatic graft rejection. As the prototype for those human exopeptidases that cleave off basic C-terminal residues, CPB1 specifically cleaves the C-terminal Arg and Lys residues with a preference for Arg. The B1 and B2 forms of procarboxypeptidase B differ from each other mainly in isoelectric point.The deduced amino acid sequence of PCPB predicts a 416-amino acid preproenzyme consisting of a 15-aa signal peptide, a 95-aa activation peptide and a 307-aa mature chain. The secreted PCPB zymogen is converted to enzymatically active CPB1 by limited proteolysis by trypsin.

Referências
  • Yamamoto, K.K. et al., 1992, J. Biol. Chem. 267: 2575-2581.
  • Pezzilli, R. et al., 1994, Digestion. 55: 73-77.
  • Barbosa Pereira, P.J. et al., 2002, J. Mol. Biol. 321: 537-547.
  • Size / Price
    Catálogo: MG50386-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"