Encomenda rápida

Text Size:AAA

Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CPA1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1260bp
Descrição de cDNA:Full length Clone DNA of Mus musculus carboxypeptidase A1 with C terminal His tag.
Sinónimo de gene:Cpa, 0910001L12Rik, Cpa1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50448-ACG$225
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50448-ACR$225
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50448-CF$195
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50448-CH$195
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50448-CM$195
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50448-CY$195
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50448-M$75
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50448-NF$195
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50448-NH$195
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50448-NM$195
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50448-NY$195
Ratazanao Carboxypeptidase A1/CPA1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50448-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Human Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

  • Catasus, L. et al., 1992, Biochem. J. 287: 299-303.
  • Moulard, M. et al., 1990, FEBS. Lett. 261: 179-183.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Size / Price
    Catálogo: MG50448-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.