After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse COX6C Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_053071.2
Tamanho de cDNA:231bp
Descrição de cDNA:Full length Clone DNA of Mus musculus cytochrome c oxidase subunit Vic.
Sinónimo de gene:Cox6c
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51387-ACG$225
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51387-ACR$225
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51387-ANG$225
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51387-ANR$225
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51387-CF$195
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51387-CH$195
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51387-CM$195
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51387-CY$195
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51387-NF$195
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51387-NH$195
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51387-NM$195
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51387-NY$195
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de expressão)MG51387-U$75
Ratazanao Cytochrome C Oxidase subunit VIc clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51387-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51387-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"