Encomenda rápida

Ratazanao CMBL clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato CMBL Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_181588.3
    Tamanho de cDNA:738bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus carboxymethylenebutenolidase-like (Pseudomonas) with N terminal His tag.
    Sinónimo de gene:2310016A09Rik
    Espécie:Mouse
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CMBL qPCR primers for gene expression analysis, MP201289 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazanao CMBL clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Product nameProduct name
    Fundo

    Carboxymethylenebutenolidase (CMBL), also known as 4-carboxymethylenebut-2-en-4-olide lactonohydrolase, maleylacetate enol- lactonase, dienelactone hydrolase, and carboxymethylene butenolide hydrolase, is a hydrolase specially belonging to the family of hydrolases. It maily acts on carboxylic ester bonds. CMBL is a human homolog of Pseudomonas dienelactone hydrolase involved in the bacterial halocatechol degradation pathway. The ubiquitous expression of human CMBL gene transcript in various tissues was observed. CMBL was demonstrated to be the primary olmesartan medoxomil (OM) bioactivating enzyme in the liver and intestine. The recombinant human CMBL expressed in mammalian cells was clearly shown to activate OM. The recombinant CMBL also converted other prodrugs having the same ester structure as OM, faropenem medoxomil and lenampicillin, to their active metabolites. CMBL exhibited a unique sensitivity to chemical inhibitors, thus, being distinguishable from other known esterases.  

    Referências
  • Ishizuka T, et al. (2010) Human Carboxymethylenebutenolidase as a Bioactivating Hydrolase of Olmesartan Medoxomil in Liver and Intestine. The Journal of Biological Chemistry. 285: 11892-902.
  • Schmidt E, et al. (1980) Chemical structure and biodegradability of halogenated aromatic compounds. Conversion of chlorinated muconic acids into maleoylacetic acid. Biochem J. 192 (1): 339-47.
  • Size / Price
    Catálogo: MG51405-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"