Encomenda rápida

Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato CLDN11 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_008770.3
    Tamanho de cDNA:624bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus claudin 11 with N terminal Myc tag.
    Sinónimo de gene:Osp, Otm, Claudin11, Claudin-11
    Espécie:Mouse
    Vetor:pCMV3-N-Myc
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CLDN11 qPCR primers for gene expression analysis, MP201325 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51441-ACG$225
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51441-ACR$225
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51441-ANG$225
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51441-ANR$225
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51441-CF$195
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51441-CH$195
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51441-CM$195
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51441-CY$195
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51441-G$75
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51441-NF$195
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51441-NH$195
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51441-NM$195
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51441-NY$195
    Ratazanao CLDN11 / Claudin-11 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51441-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Claudin-11, also known as CLDN11, belongs to the group of claudins. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands function as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions.Claudin-11 is a tight junction associated protein and is a major component of central nervous system (CNS) myelin that is necessary for normal CNS function. Human blood-testis barrier disruption is related to a dysfunction of CLDN11 gene. It plays an important role in regulating proliferation and migration of oligodendrocytes.

    Referências
  • Tsukita S, et al. (2001) Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol. 2(4): 285-3.
  • Heiskala M, et al. (2001) The roles of claudin superfamily proteins in paracellular transport. Traffic 2. (2):93-8.
  • Bronstein JM, et al. (2000) Involvement of OSP/claudin-11 in oligodendrocyte membrane interactions: role in biology and disease. J Neurosci Res. 59(6):706-11.
  • Size / Price
    Catálogo: MG51441-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"