After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CKM Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:X03233.1
Tamanho de cDNA:1146bp
Descrição de cDNA:Full length Clone DNA of Mus musculus creatine kinase, muscle.
Sinónimo de gene:MCK, Ckmm, M-CK
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51356-ACG$225
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51356-ACR$225
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51356-ANG$225
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51356-ANR$225
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51356-CF$195
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51356-CH$195
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51356-CM$195
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51356-CY$195
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de expressão)MG51356-G$75
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51356-NF$195
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51356-NH$195
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51356-NM$195
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51356-NY$195
Ratazanao CKM / CK-MM clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51356-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

CKM, also known as CK-MM, is mainly expressed in skeletal muscle. As the primary CK isoenzyme, it also can be detected in heart muscle. CKM is a subunit of creatine kinase (CK). CK is an enzyme expressed by various tissues and cell types. It catalyses the conversion of creatine and consumes adenosine triphosphate (ATP) to create phosphocreatine and adenosine diphosphate (ADP). In the cells, the cytosolic CK enzymes consist of two subunits, which can be either B (brain type) or M (muscle type).

Referências
  • Goldblatt H. 1969, Laboratory Investigation. 21 (2): 126-8.
  • Hekimsoy Zeliha. et al., 2005, Endocrine Research. 31 (3): 171-5.
  • Döring F. et al., 2011, Scand J Med Sci Sports. 21(6):841-5.
  • Size / Price
    Catálogo: MG51356-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"