After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CKB Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_021273.4
Tamanho de cDNA:1146bp
Descrição de cDNA:Full length Clone DNA of Mus musculus creatine kinase, brain.
Sinónimo de gene:Bck, Ck3, B-CK, Ck-3, Ckbb
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51386-ACG$225
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51386-ACR$225
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51386-ANG$225
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51386-ANR$225
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51386-CF$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51386-CH$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51386-CM$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51386-CY$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51386-NF$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51386-NH$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51386-NM$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51386-NY$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de expressão)MG51386-U$75
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51386-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. It belongs to the ATP:guanido phosphotransferase family. CKB consists of a homodimer of two identical brain-type CK-B subunits. CKB is a cytoplasmic enzyme involved in cellular energy homeostasis, with certain fractions of the enzyme being bound to cell membranes, ATPases, and a variety of ATP-requiring enzymes in the cell. There, CKB forms tightly coupled microcompartments for in situ regeneration of ATP that has been used up. CKB reversibly catalyzes the transfer of "energy-rich" phosphate between ATP and creatine or between phospho-creatine (PCr) and ADP. Its functional entity is a homodimer in brain, smooth muscle as well as in other tissues and cells such as neuronal cells, retina, kidney, bone etc.

Referências
  • Wienker TF, et al. (1985) A dominant mutation causing ectopic expression of the creatine kinase B gene maps on chromosome 14. Cytogenet Cell Genet. 40:776.
  • Mariman EC, et al. (1989) Complete nucleotide sequence of the human creatine kinase B gene. Nucleic Acids Res. 17(15):6385.
  • Bong S, et al. (2008) Structural studies of human brain-type creatine kinase complexed with the ADP–Mg2+–NO3−–creatine transition-state analogue complex. FEBS Letters. 582(28): 3959-65.
  • Size / Price
    Catálogo: MG51386-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"