Encomenda rápida

Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato CKB Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_021273.4
Tamanho de cDNA:1146bp
Descrição de cDNA:Full length Clone DNA of Mus musculus creatine kinase, brain.
Sinónimo de gene:Bck, Ck3, B-CK, Ck-3, Ckbb
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CKB qPCR primers for gene expression analysis, MP201259 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51386-ACG$225
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51386-ACR$225
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51386-ANG$225
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51386-ANR$225
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51386-CF$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51386-CH$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51386-CM$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51386-CY$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51386-NF$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51386-NH$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51386-NM$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51386-NY$195
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de expressão)MG51386-U$75
Ratazanao CKB / Creatine kinase B type clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51386-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. It belongs to the ATP:guanido phosphotransferase family. CKB consists of a homodimer of two identical brain-type CK-B subunits. CKB is a cytoplasmic enzyme involved in cellular energy homeostasis, with certain fractions of the enzyme being bound to cell membranes, ATPases, and a variety of ATP-requiring enzymes in the cell. There, CKB forms tightly coupled microcompartments for in situ regeneration of ATP that has been used up. CKB reversibly catalyzes the transfer of "energy-rich" phosphate between ATP and creatine or between phospho-creatine (PCr) and ADP. Its functional entity is a homodimer in brain, smooth muscle as well as in other tissues and cells such as neuronal cells, retina, kidney, bone etc.

Referências
  • Wienker TF, et al. (1985) A dominant mutation causing ectopic expression of the creatine kinase B gene maps on chromosome 14. Cytogenet Cell Genet. 40:776.
  • Mariman EC, et al. (1989) Complete nucleotide sequence of the human creatine kinase B gene. Nucleic Acids Res. 17(15):6385.
  • Bong S, et al. (2008) Structural studies of human brain-type creatine kinase complexed with the ADP–Mg2+–NO3−–creatine transition-state analogue complex. FEBS Letters. 582(28): 3959-65.
  • Size / Price
    Catálogo: MG51386-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"