Encomenda rápida

Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CHAC2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_175175.4
Tamanho de cDNA:537 bp
Descrição de cDNA:Full length Clone DNA of Mus musculus ChaC, cation transport regulator 2
Sinónimo de gene:Chac2
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52452-ACG$225
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52452-ACR$225
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52452-ANG$225
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52452-ANR$225
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52452-CF$75
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52452-CH$195
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52452-CM$195
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52452-CY$195
Mouse CHAC2 Gene cDNA clone plasmidMG52452-G$75
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52452-NF$195
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52452-NH$195
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52452-NM$195
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52452-NY$195
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52452-U$75
Ratazanao CHAC2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52452-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52452-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"