Encomenda rápida

Ratazanao CD74 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato CD74 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001042605.1
    Tamanho de cDNA:840bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) with N terminal His tag.
    Sinónimo de gene:Ii, CLIP, DHLAG, HLADG, Ia-GAMMA, Cd74
    Espécie:Mouse
    Vetor:pCMV3-SP-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD74 qPCR primers for gene expression analysis, MP200713 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Fundo

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD74, also known as HLA class2 histocompatibility antigen gamma chain and HLA-DR antigens-associated invariant chain, is a polypeptide involved in the formation and transport of MHC class2 protein. CD74 is expressed by B cells, macrophages, and Reed-Sternberg cells. When MHC class 2 protein was in the rough ER, its peptide-binding cleft was blocked by CD74 to prevent it from interacting with the endogenous peptides. CD74 also serves to facilitate MHC class2's export from ER.

    Referências
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Moynes R, et al. (1997) A marker to distinguish atypical fibroxanthoma from malignant fibrous histiocytoma. Cancer. 79 (11): 2115-24.
  • Gabrielle FA, et al. (2008) Regulation of dendritic cell migration by CD74, the MHC class 2-associated invariant chain. Science. 322 (5908): 1705-10.
  • Leng L, et al. (2003) MIF signal transduction initiated by binding to CD74. JEM.197 (11): 1467-76.
  • Size / Price
    Catálogo: MG50738-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"