After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao CD59a / Protectin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CD59A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_007652.4
Tamanho de cDNA:372bp
Descrição de cDNA:Full length Clone DNA of Mus musculus CD59 antigen with N terminal His tag.
Sinónimo de gene:Cd59, AA987121, protectin, Cd59a
Espécie:Mouse
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao CD59a / Protectin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Product nameProduct name
Fundo

Protectin, a complement regulatory protein, also known as CD59, or MIRL (membrane inhibitor of reactive lysis) is a small protein that inhibits the complement membrane attack complex by binding C5b678 and preventing C9 from binding and polymerizing. The amino-terminal 25 amino acids represented a typical signal peptide sequence and the carboxy-terminal hydrophobic amino acids were characteristic for phosphatidylinositol-anchored proteins.It was found that the CD59/Protectin antigen is a small protein sometimes associated with larger components (45 and 80 kD) in urine. CD59/Protectin antigen was released from the surface of transfected COS cells by phosphatidylinositol-specific phospholipase C, demonstrating that it is attached to the cell membrane by means of a glycolipid anchor; it is therefore likely to be absent from the surface of affected erythrocytes in the disease paroxysmal nocturnal hemoglobinuria.

Referências
  • Huang Y, et al. (2006) Defining the CD59-C9 binding interaction. J Biol Chem. 281 (37): 27398-404.
  • Sawada R, et al. (1990) Isolation and expression of the full-length cDNA encoding CD59 antigen of human lymphocytes. DNA Cell Biol. 9(3): 213-20.
  • Philbrick WM, et al. (1990) The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility. Eur J Immunol. 20(1): 87-92.
  • Size / Price
    Catálogo: MG50724-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"