Encomenda rápida

Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato CD40LG Informações sobre o produto de clone de cDNA
Tamanho de cDNA:783bp
Descrição de cDNA:Full length Clone DNA of Mus musculus CD40 ligand with C terminal Myc tag.
Sinónimo de gene:IGM; IMD3; Ly62; TRAP; gp39; CD154; Cd40l; HIGM1; Ly-62; T-BAM; CD40-L; Tnfsf5
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
( We provide with CD40LG qPCR primers for gene expression analysis, MP200350 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50327-ACG$225
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50327-ACR$225
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50327-CF$195
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50327-CH$195
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50327-CM$195
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50327-CY$195
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50327-G$75
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50327-M$75
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50327-NF$195
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50327-NH$195
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50327-NM$195
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50327-NY$195
Ratazanao CD40 Ligand/CD40L/CD154 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50327-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD154, also known as CD40 ligand or CD40L, is a member of the TNF superfamily. While CD154 was originally found on T cell surface, its expression has since been found on a wide variety of cells, including platelets, mast cells, macrophages and NK cells. CD154's ability is achieved through binding to the CD40 on antigen- presenting cells (APC). In the macrophage cells, the primary signal for activation is IFN-γ from Th1 type CD4 T cells. The secondary signal is CD40L on the T cell, which interacting with the CD40 molecules, helping increase the level of activation.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Grewal IS, et al. (1998) CD40 and CD154 in cell-mediated immunity. Annual Review of Immunology. 16: 111-35.
  • Size / Price
    Catálogo: MG50327-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.