CD155 / PVR cDNA ORF Clone, Mouse, untagged

Cat: MG50259-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CD155 / PVR Reagents

CRO Services

Product recommended


All CD155 / PVR Reagents

CD155 / PVR cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1227 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse poliovirus receptor.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI (two restriction sites) + XbaI (6.10kb + 0.63kb + 0.6kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD155 / PVR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD155 / PVR cDNA ORF Clone, Mouse, untagged Validated Images

Mouse CD155/PVR Gene Plasmid Map 7572

CD155 / PVR cDNA ORF Clone, Mouse, untagged Alternative Names

3830421F03Rik cDNA ORF Clone, Mouse;CD155 cDNA ORF Clone, Mouse;D7Ertd458e cDNA ORF Clone, Mouse;HVED cDNA ORF Clone, Mouse;mE4 cDNA ORF Clone, Mouse;necl-5 cDNA ORF Clone, Mouse;PVS cDNA ORF Clone, Mouse;Taa1 cDNA ORF Clone, Mouse;Tage4 cDNA ORF Clone, Mouse

CD155 / PVR Background Information

CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane single-span glycoprotein, and belongs to the nectins and nectin-like (Necl) subfamily. CD155 was originally identified based on its ability to mediate the cell attachment and entry of poliovirus (PV), an etiologic agent of the central nervous system disease poliomyelitis. The normal cellular function is in the establishment of intercellular adherens junctions between epithelial cells. CD155 may assist in an efficient humoral immune response generated within the intestinal immune system. It has been demonstrated that CD155 can be recognized and bond by DNAM-1 and CD96 which promote the adhension, migration and NK-cell killing, and thus efficiently prime cell-mediated tumor-specific immunity.Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets Immunotherapy   Cancer Immunotherapy   Targeted Therapy
Full Name
poliovirus receptor
References
  • Freistadt MS, et al. (2000) Hematopoietic cells from CD155-transgenic mice express CD155 and support poliovirus replication ex vivo. Microb Pathog. 29(4): 203-12.
  • Sato T, et al. (2004) Involvement of heterophilic trans-interaction of Necl-5/Tage4/PVR/CD155 with nectin-3 in formation of nectin- and cadherin-based adherens junctions. Genes Cells. 9(9): 791-9.
  • Kakunaga S, et al. (2004) Enhancement of serum- and platelet-derived growth factor-induced cell proliferation by Necl-5/Tage4/poliovirus receptor/CD155 through the Ras-Raf-MEK-ERK signaling. J Biol Chem. 279(35): 36419-25.
  • Sato T, et al. (2005) Common signaling pathway is used by the trans-interaction of Necl-5/Tage4/PVR/CD155 and nectin, and of nectin and nectin during the formation of cell-cell adhesion. Cancer Sci. 96(9): 578-89.
  • Minami Y, et al. (2007) Involvement of up-regulated Necl-5/Tage4/PVR/CD155 in the loss of contact inhibition in transformed NIH3T3 cells. Biochem Biophys Res Commun. 352(4): 856-60.
  • CD155 / PVR cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD155 / PVR cDNA ORF Clone in Cloning Vector, Rhesus CG90005-G
    CD155 / PVR cDNA ORF Clone, Rhesus, untagged CG90005-UT
    CD155 / PVR cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90005-ACG
    CD155 / PVR Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90005-ACGLN
    CD155 / PVR cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90005-ACR
    CD155 / PVR cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90005-CF
    CD155 / PVR cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90005-NF
    CD155 / PVR cDNA ORF Clone, Rhesus, C-His tag CG90005-CH
    CD155 / PVR cDNA ORF Clone, Rhesus, N-His tag CG90005-NH
    CD155 / PVR cDNA ORF Clone, Rhesus, C-HA tag CG90005-CY
    CD155 / PVR cDNA ORF Clone, Rhesus, N-HA tag CG90005-NY
    CD155 / PVR cDNA ORF Clone, Rhesus, C-Myc tag CG90005-CM
    CD155 / PVR cDNA ORF Clone, Rhesus, N-Myc tag CG90005-NM

    CD155 / PVR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD155 / PVR cDNA ORF Clone in Cloning Vector, Rat RG80007-G
    CD155 / PVR cDNA ORF Clone, Rat, untagged RG80007-UT
    CD155 / PVR cDNA ORF Clone, Rat, C-GFPSpark® tag RG80007-ACG
    CD155 / PVR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80007-ACGLN
    CD155 / PVR cDNA ORF Clone, Rat, C-OFPSpark® tag RG80007-ACR
    CD155 / PVR cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80007-CF
    CD155 / PVR cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80007-NF
    CD155 / PVR cDNA ORF Clone, Rat, C-His tag RG80007-CH
    CD155 / PVR cDNA ORF Clone, Rat, N-His tag RG80007-NH
    CD155 / PVR cDNA ORF Clone, Rat, C-HA tag RG80007-CY
    CD155 / PVR cDNA ORF Clone, Rat, N-HA tag RG80007-NY
    CD155 / PVR cDNA ORF Clone, Rat, C-Myc tag RG80007-CM
    CD155 / PVR cDNA ORF Clone, Rat, N-Myc tag RG80007-NM
    CD155 / PVR qPCR Primer Pairs, Rat RP300006

    CD155 / PVR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD155 / PVR cDNA ORF Clone in Cloning Vector, Mouse MG50259-M
    CD155 / PVR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50259-ACGLN
    CD155 / PVR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50259-ACG
    CD155 / PVR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50259-ACR
    CD155 / PVR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50259-CF
    CD155 / PVR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50259-NF
    CD155 / PVR cDNA ORF Clone, Mouse, C-His tag MG50259-CH
    CD155 / PVR cDNA ORF Clone, Mouse, N-His tag MG50259-NH
    CD155 / PVR cDNA ORF Clone, Mouse, C-HA tag MG50259-CY
    CD155 / PVR cDNA ORF Clone, Mouse, N-HA tag MG50259-NY
    CD155 / PVR cDNA ORF Clone, Mouse, C-Myc tag MG50259-CM
    CD155 / PVR cDNA ORF Clone, Mouse, N-Myc tag MG50259-NM
    CD155 / PVR qPCR Primer Pairs, Mouse MP200285

    CD155 / PVR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD155 / PVR cDNA ORF Clone in Cloning Vector, Human HG10110-M
    CD155 / PVR cDNA ORF Clone in Cloning Vector, Human HG10109-M
    CD155 / PVR cDNA ORF Clone, Human, untagged HG10109-UT
    CD155 / PVR cDNA ORF Clone, Human, untagged HG10110-UT
    CD155 / PVR cDNA ORF Clone, Human, untagged HG29682-UT
    CD155 / PVR cDNA ORF Clone, Human, C-GFPSpark® tag HG10110-ACG
    CD155 / PVR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29682-ACGLN
    CD155 / PVR cDNA ORF Clone, Human, C-GFPSpark® tag HG10109-ACG
    CD155 / PVR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10109-ACGLN
    CD155 / PVR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10110-ACGLN
    CD155 / PVR cDNA ORF Clone, Human, C-OFPSpark® tag HG10110-ACR
    CD155 / PVR cDNA ORF Clone, Human, C-OFPSpark® tag HG10109-ACR
    CD155 / PVR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10110-CF
    CD155 / PVR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10109-CF
    CD155 / PVR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10109-NF
    CD155 / PVR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10110-NF
    CD155 / PVR cDNA ORF Clone, Human, C-His tag HG10110-CH
    CD155 / PVR cDNA ORF Clone, Human, C-His tag HG10109-CH
    CD155 / PVR cDNA ORF Clone, Human, N-His tag HG10110-NH
    CD155 / PVR cDNA ORF Clone, Human, N-His tag HG10109-NH
    CD155 / PVR cDNA ORF Clone, Human, C-HA tag HG10110-CY
    CD155 / PVR cDNA ORF Clone, Human, C-HA tag HG10109-CY
    CD155 / PVR cDNA ORF Clone, Human, N-HA tag HG10109-NY
    CD155 / PVR cDNA ORF Clone, Human, N-HA tag HG10110-NY
    CD155 / PVR cDNA ORF Clone, Human, C-Myc tag HG10109-CM
    CD155 / PVR cDNA ORF Clone, Human, C-Myc tag HG10110-CM
    CD155 / PVR cDNA ORF Clone, Human, N-Myc tag HG10109-NM
    CD155 / PVR cDNA ORF Clone, Human, N-Myc tag HG10110-NM
    CD155 / PVR qPCR Primer Pairs, Human HP100017

    CD155 loss enhances tumor suppression via combined host and tumor-intrinsic mechanisms

    Author:
    Li, XY;Das, I;Lepletier, A;Addala, V;Bald, T;Stannard, K;Barkauskas, D;Liu, J;Aguilera, AR;Takeda, K;Braun, M;Nakamura, K;Jacquelin, S;Lane, SW;Teng, MW;Dougall, WC;Smyth, MJ;
    Year:
    2018
    Journal:
    J. Clin. Invest.
    Application:
    expression

    PubMed ID: 29757192

     
    info info
    添加购物车成功! 添加购物车失败!