Encomenda rápida

Text Size:AAA

Ratazanao CD10/Neprilysin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse MME Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2253bp
Descrição de cDNA:Full length Clone DNA of Mus musculus membrane metallo endopeptidase with N terminal Myc tag.
Sinónimo de gene:NEP, SFE, CD10, CALLA, C85356, 6030454K05Rik
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao CD10/Neprilysin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 10 (CD10), also known as Neprilysin and neutral endopeptidase, is a member of the CD system. CD10 is a zinc-dependent metalloprotease enzyme that had function to degrade a number of small secreted peptides such as the amyloid beta peptide. It exist as a membrane-bound protein and have high concentration in kidney and lung tissues. Mutations in the CD10 gene can induce the familial forms of Alzheimer's disease, providing strong evidence for the protein's association with the Alzheimer's disease process. CD10 is also associated with other biochemical processes.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Dogan, et al. (2000) CD10 and BCL-6 Expression in Paraffin Sections of Normal Lymphoid Tissue and B-Cell Lymphomas. American Journal of Surgical Pathology. 24(6): 846-52.
  • Size / Price
    Catálogo: MG50218-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.