Encomenda rápida

Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CAMK1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1125bp
Descrição de cDNA:Full length Clone DNA of Mus musculus calcium/calmodulin-dependent protein kinase I with C terminal Flag tag.
Sinónimo de gene:AI505105, CaMKIalpha, D6Ertd263e
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52781-ACG$225
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52781-ACR$225
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52781-ANG$225
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52781-ANR$225
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52781-CF$195
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52781-CH$195
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52781-CM$195
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52781-CY$195
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52781-G$75
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52781-NF$195
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52781-NH$195
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52781-NM$195
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52781-NY$195
Ratazanao CAMKI/CAMK1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52781-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Calcium/calmodulin-dependent protein kinase or CaM kinases are serine/threonine-specific protein kinases that are primarily regulated by the Calcium/calmodulin complex. These kinases show a memory effect on activation. CaM kinases activity can outlast the intracellular calcium transient that is needed to activate it. In neurons, this property is important for the induction of synaptic plasticity. Pharmacological inhibition of CaM kinases II blocks the induction of long-term potentiation. Upon activation, CaM kinases II phosphorylates postsynaptic glutamate receptors and changes the electrical properties of the synapse.

Calcium/calmodulin-dependent protein kinase type 1D, also known as CaM kinase I delta, CaM kinase ID, CaMKI-like protein kinase, CKLiK and CAMK1D, is a member of the protein kinase superfamily and CaMK subfamily. It contains one protein kinase domain. CAMK1D is broadly expressed. It is highly and mostly expressed in polymorphonuclear leukocytes (neutrophilic and eosinophilic granulocytes) while little or no expression is observed in monocytes and lymphocytes. Engineered overexpression of CAMK1D in non-tumorigenic breast epithelial cells led to increased cell proliferation, and molecular and phenotypic alterations indicative of epithelial-mesenchymal transition (EMT), including loss of cell-cell adhesions and increased cell migration and invasion. CAMK1D is a potential therapeutic target with particular relevance to clinically unfavorable basal-like tumors.

  • Lisman, JE. et al., 1985, Proc Natl Acad Sci USA. 82 (9): 3055-7.
  • Bergamaschi, A. et al., 2008, Mol Oncol. 2 (4): 327-39.
  • White RB. et al., 2008, Physiological genomics, 33 (1): 41-9.
  • Schleinitz, D. et al., 2010, Horm Metab Res. 42 (1): 14-22.
  • Size / Price
    Catálogo: MG52781-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.