Encomenda rápida

Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CALM2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_007589.5
Tamanho de cDNA:450bp
Descrição de cDNA:Full length Clone DNA of Mus musculus calmodulin 2.
Sinónimo de gene:AL024017, 1500001E21Rik
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51329-ACG$225
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51329-ACR$225
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51329-ANG$225
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51329-ANR$225
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51329-CF$195
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51329-CH$195
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51329-CM$195
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51329-CY$195
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51329-NF$195
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51329-NH$195
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51329-NM$195
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51329-NY$195
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51329-U$75
Ratazanao Calmodulin 2 / CALM2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51329-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Calmodulin 2, also known as CALM2, is a calmodulin. Calmodulin 2 mediates the control of a large number of enzymes, ion channels and other proteins by Ca(2+). It is involved in a genetic pathway that regulates the centrosome cycle and progression through cytokinesis. Calmodulin 2 gene may be a genetic determinant of hip osteoarthritis (OA). OA is a degenerative disease characterized by gradual loss of articular cartilage and is a leading cause of disability in elderly populations. CALM2 was most abundantly expressed in articular chondrocytes and OA cartilage.

Referências
  • Egli R, et al. (1993) Localization of the human bona fide calmodulin genes CALM1, CALM2, and CALM3 to chromosomes 14q24-q31, 2p21.1-p21.3, and 19q13.2-q13.3. Genomics. 16(2): 461-5.
  • Mikiko, et al. (2002) Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by anchoring gamma-tubulin ring complex. Mol Biol Cell. 13(9):3235-45.
  • SenGupta B, et al. (1987) Molecular analysis of human and rat calmodulin complementary DNA clones. Evidence for additional active genes in these species. J Biol Chem. 262(34): 16663-70.
  • Size / Price
    Catálogo: MG51329-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"