Encomenda rápida

Text Size:AAA

Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CADM1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1338bp
Descrição de cDNA:Full length Clone DNA of Mus musculus cell adhesion molecule 1 with N terminal HA tag.
Sinónimo de gene:Bl2, ST17, Igsf4, Necl2, RA175, Tslc1, Igsf4a, RA175A, RA175B, RA175C, RA175N, SgIGSF, SynCam, AI987920, 2900073G06Rik, 3100001I08Rik, Cadm1
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50538-ACG$225
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50538-ACR$225
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50538-CF$195
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50538-CH$195
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50538-CM$195
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50538-CY$195
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50538-G$75
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50538-NF$195
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50538-NH$195
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50538-NM$195
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50538-NY$195
Ratazanao SynCam/CADM1/TSLC1/IGSF4 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50538-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Members of the immunoglobulin superfamily often play key roles in intercellular adhesion. IGSF4 is a novel immunoglobulin (Ig)-like intercellular adhesion molecule. Three Ig-like domains are included in the extracellular domain of IGSF4 and mediate homophilic or heterophilic interactions independently of Ca2+. The cytoplasmic domain of IGSF4 contains the binding motifs that connect to actin fibers. Since IGSF4 has been characterized by several independent research groups, this molecule is called by three names, TSLC1, SgIGSF and SynCAM. IGSF4 was first characterized as a tumor suppressor of non-small cell lung cancer and termed TSLC1. It is a single-pass type I membrane protein which belongs to the nectin family, which may be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. In addition, CADM1 may play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa. In neuroblastoma, loss of CADM1 expression has recently been found in disseminated tumours with adverse outcome, prompting us to investigate its role in neuroblastoma tumour progression. The downregulation of CADM1 tumour suppressor gene expression is a critical event in neuroblastoma pathogenesis resulting in tumour progression.

  • Watabe K, et al. (2003) IGSF4: a new intercellular adhesion molecule that is called by three names, TSLC1, SgIGSF and SynCAM, by virtue of its diverse function. Histol Histopathol. 18(4): 1321-9.
  • Fujita E, et al. (2005) Distribution of RA175/TSLC1/SynCAM, a member of the immunoglobulin superfamily, in the developing nervous system. Brain Res Dev Brain Res. 154(2): 199-209.
  • Fujita E, et al. (2006) Oligo-astheno-teratozoospermia in mice lacking RA175/TSLC1/SynCAM/IGSF4A, a cell adhesion molecule in the immunoglobulin superfamily. Mol Cell Biol. 26(2): 718-26.
  • Nowacki S, et al. (2008) Expression of the tumour suppressor gene CADM1 is associated with favourable outcome and inhibits cell survival in neuroblastoma. Oncogene. 27(23): 3329-38.
  • Size / Price
    Catálogo: MG50538-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.