After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse CA4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_007607.2
Tamanho de cDNA:918bp
Descrição de cDNA:Full length Clone DNA of Mus musculus carbonic anhydrase 4 with C terminal Myc tag.
Sinónimo de gene:Ca4, AW456718, Car4
Espécie:Mouse
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50350-ACG$225
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50350-ACR$225
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50350-CF$195
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50350-CH$195
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50350-CH$195
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50350-CM$195
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50350-CY$195
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50350-M$75
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50350-NF$195
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50350-NH$195
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50350-NM$195
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50350-NY$195
Ratazanao Carbonic Anhydrase IV / Car4 / CA4 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50350-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase IV (CAIV) is a membrane-associated enzyme anchored to plasma membrane surfaces by a phosphatidylinositol glycan linkage. CAIV is a high-activity isozyme in CO2 hydration comparable to that of CAII. Furthermore, CAIV is more active in HCO3- dehydration than is CAII. However, the esterase activity of CAIV is decreased 150-fold compared to CAII.

Referências
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Baird TT, et al. (1997) Catalysis and Inhibition of Human Carbonic Anhydrase IV. Biochemistry. 36 (9): 2669-78.
  • Size / Price
    Catálogo: MG50350-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"