After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse C5AR1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001173550.1
Tamanho de cDNA:1056bp
Descrição de cDNA:Full length Clone DNA of Mus musculus complement component 5a receptor 1 with N terminal His tag.
Sinónimo de gene:C5aR, C5r1, Cd88, D7Msu1, C5ar1
Espécie:Mouse
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50748-ACG$225
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50748-ACR$225
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50748-CF$195
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50748-CH$195
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50748-CM$195
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50748-CY$195
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50748-G$75
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50748-NF$195
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50748-NH$195
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50748-NM$195
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50748-NY$195
Ratazanao C5a anaphylatoxin receptor 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50748-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"