Encomenda rápida

Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato BRMS1L Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:972 bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus breast cancer metastasis-suppressor 1-like
    Sinónimo de gene:0710008O11Rik,AI159718,BRMS1,D12Ertd407e
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    ( We provide with BRMS1L qPCR primers for gene expression analysis, MP201487 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51604-ACG$225
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51604-ACR$225
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51604-ANG$225
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51604-ANR$225
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51604-CF$195
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51604-CH$195
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51604-CM$195
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51604-CY$195
    Mouse BRMS1L Gene cDNA clone plasmidMG51604-G$75
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51604-NF$195
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51604-NH$195
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51604-NM$195
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51604-NY$195
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de expressão)MG51604-U$75
    Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51604-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG51604-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.