After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse BRMS1L Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_026011.3
Tamanho de cDNA:972 bp
Descrição de cDNA:Full length Clone DNA of Mus musculus breast cancer metastasis-suppressor 1-like
Sinónimo de gene:0710008O11Rik,AI159718,BRMS1,D12Ertd407e
Espécie:Mouse
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51604-ACG$225
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51604-ACR$225
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51604-ANG$225
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51604-ANR$225
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51604-CF$75
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51604-CH$195
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51604-CM$195
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51604-CY$195
Mouse BRMS1L Gene cDNA clone plasmidMG51604-G$75
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51604-NF$195
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51604-NH$195
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51604-NM$195
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51604-NY$195
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de expressão)MG51604-U$75
Ratazanao BRMS1L clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51604-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"