BMP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50439-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All BMP4 Reagents

CRO Services

Product recommended


All BMP4 Reagents

BMP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1227 bp
Description
Full length Clone DNA of Mouse bone morphogenetic protein 4 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names

Bmp-4 cDNA ORF Clone, Mouse;Bmp2b cDNA ORF Clone, Mouse;Bmp2b-1 cDNA ORF Clone, Mouse;Bmp2b1 cDNA ORF Clone, Mouse

BMP4 Background Information

BMP4 (bone morphogenetic protein-4)-directed differentiation of human embryonic stem cells (ESCd). Autophagy is a conserved catabolic process with complicated roles in tumor development. Bone morphogenetic protein 4 (BMP4), a member of the transforming growth factor (TGF-β) family of regulatory proteins, plays a crucial role in human malignancies. BMP4 treatment promoted HCC cells proliferation and induced autophagy. Mechanistic study revealed that the induction of autophagy by BMP4 was mediated through activating the JNK1/Bcl2 pathway. And the JNK1 inhibitor and knockdown of JNK1 could attenuate autophagy induced by BMP4 and eliminated BMP4-promoted HCC cells growth. BMP4 promoted HCC proliferation by autophagy activation through JNK1/Bcl-2 signaling.
Full Name
bone morphogenetic protein 4

BMP4 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
BMP4 cDNA ORF Clone in Cloning Vector, Rhesus CG90038-G
BMP4 cDNA ORF Clone, Rhesus, untagged CG90038-UT
BMP4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90038-ACGLN
BMP4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90038-ACG
BMP4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90038-ACR
BMP4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90038-CF
BMP4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90038-NF
BMP4 cDNA ORF Clone, Rhesus, C-His tag CG90038-CH
BMP4 cDNA ORF Clone, Rhesus, N-His tag CG90038-NH
BMP4 cDNA ORF Clone, Rhesus, C-HA tag CG90038-CY
BMP4 cDNA ORF Clone, Rhesus, N-HA tag CG90038-NY
BMP4 cDNA ORF Clone, Rhesus, C-Myc tag CG90038-CM
BMP4 cDNA ORF Clone, Rhesus, N-Myc tag CG90038-NM

BMP4 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
BMP4 cDNA ORF Clone in Cloning Vector, Canine DG70074-G
BMP4 cDNA ORF Clone, Canine, untagged DG70074-UT
BMP4 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70074-ACGLN
BMP4 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70074-ACG
BMP4 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70074-ACR
BMP4 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70074-CF
BMP4 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70074-NF
BMP4 cDNA ORF Clone, Canine, C-His tag DG70074-CH
BMP4 cDNA ORF Clone, Canine, N-His tag DG70074-NH
BMP4 cDNA ORF Clone, Canine, C-HA tag DG70074-CY
BMP4 cDNA ORF Clone, Canine, N-HA tag DG70074-NY
BMP4 cDNA ORF Clone, Canine, C-Myc tag DG70074-CM
BMP4 cDNA ORF Clone, Canine, N-Myc tag DG70074-NM

BMP4 cDNA ORF Clone, Danio rerio (zebrafish), Related Products

Product Name Catalog#(PDF)
BMP4 cDNA ORF Clone in Cloning Vector, Danio rerio (zebrafish) ZG63001-G
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), untagged ZG63001-UT
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-GFPSpark® tag ZG63001-ACG
BMP4 Lentiviral cDNA ORF Clone, Danio rerio (zebrafish), C-GFPSpark® tag ZG63001-ACGLN
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-OFPSpark® tag ZG63001-ACR
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-DDK (Flag®) tag ZG63001-CF
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), N-DDK (Flag®) tag ZG63001-NF
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-His tag ZG63001-CH
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), N-His tag ZG63001-NH
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-HA tag ZG63001-CY
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), N-HA tag ZG63001-NY
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), C-Myc tag ZG63001-CM
BMP4 cDNA ORF Clone, Danio rerio (zebrafish), N-Myc tag ZG63001-NM

BMP4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BMP4 cDNA ORF Clone in Cloning Vector, Mouse MG50439-G
BMP4 cDNA ORF Clone, Mouse, untagged MG50439-UT
BMP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50439-ACGLN
BMP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50439-ACG
BMP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50439-ACR
BMP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50439-G-F
BMP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50439-CF
BMP4 cDNA ORF Clone, Mouse, C-His tag MG50439-CH
BMP4 cDNA ORF Clone, Mouse, N-His tag MG50439-NH
BMP4 cDNA ORF Clone, Mouse, C-HA tag MG50439-CY
BMP4 cDNA ORF Clone, Mouse, N-HA tag MG50439-NY
BMP4 cDNA ORF Clone, Mouse, C-Myc tag MG50439-CM
BMP4 cDNA ORF Clone, Mouse, N-Myc tag MG50439-NM
BMP4 qPCR Primer Pairs, Mouse MP200448

BMP4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BMP4 cDNA ORF Clone in Cloning Vector, Human HG10609-G
BMP4 cDNA ORF Clone, Human, untagged HG10609-UT
BMP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10609-ACGLN
BMP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10609-ACG
BMP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10609-ACR
BMP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10609-CF
BMP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10609-NF
BMP4 cDNA ORF Clone, Human, C-His tag HG10609-CH
BMP4 cDNA ORF Clone, Human, N-His tag HG10609-NH
BMP4 cDNA ORF Clone, Human, C-HA tag HG10609-CY
BMP4 cDNA ORF Clone, Human, N-HA tag HG10609-NY
BMP4 cDNA ORF Clone, Human, C-Myc tag HG10609-CM
BMP4 cDNA ORF Clone, Human, N-Myc tag HG10609-NM
BMP4 qPCR Primer Pairs, Human HP100595
info info
添加购物车成功! 添加购物车失败!