After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse BID Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_007544.3
Tamanho de cDNA:588bp
Descrição de cDNA:Full length Clone DNA of Mus musculus BH3 interacting domain death agonist with C terminal Myc tag.
Sinónimo de gene:AI875481, AU022477, 2700049M22Rik, Bid
Espécie:Mouse
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50351-ACG$225
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50351-ACR$225
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50351-ANG$225
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50351-ANR$225
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50351-CF$195
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50351-CH$195
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50351-CM$195
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50351-CY$195
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de expressão)MG50351-M$75
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50351-NF$195
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50351-NH$195
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50351-NM$195
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50351-NY$195
Ratazanao p22 BID clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50351-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The BH3 interacting domain death agonist (BID) is a pro-apoptotic member of the Bcl-2 protein family, which contains only the BH3 domain, and is required for its interaction with the Bcl-2 family proteins and for its pro-death activity. BID is important to cell death mediated by these proteases and thus is the sentinel to protease-mediated death signals. Recent studies further indicate that Bid may be more than just a killer molecule, it could be also involved in the maintenance of genomic stability by engaging at mitosis checkpoint. BID is an integrating key regulator of the intrinsic death pathway that amplifies caspase-dependent and caspase-independent execution of neuronal apoptosis. Therefore pharmacological inhibition of BID provides a promising therapeutic strategy in neurological diseases where programmed cell death is prominent. BID is activated by Caspase 8 in response to Fas/TNF-R1 death receptor activation. Activated BID is translocated to mitochondria and induces cytochrome c release, which in turn activates downstream caspases. BID action has been proposed to involve the mitochondrial re-location of its truncated form, tBid, to facilitate the release of apoptogenic proteins like cytochrome c.

Referências
  • Gross A. (2006) BID as a double agent in cell life and death. Cell Cycle. 5(6): 582-4.
  • Yin XM. (2007) Bid, a BH3-only multi-functional molecule, is at the cross road of life and death. Gene. 369: 7-19.
  • Esposti MD. (2002) The roles of Bid. Apoptosis. 7(5): 433-40.
  • Yin XM. (2000) Signal transduction mediated by Bid, a pro-death Bcl-2 family proteins, connects the death receptor and mitochondria apoptosis pathways. Cell Res. 10(3): 161-7.
  • Yin XM. (2000) Bid, a critical mediator for apoptosis induced by the activation of Fas/TNF-R1 death receptors in hepatocytes. J Mol Med. 78(4): 203-11.
  • Size / Price
    Catálogo: MG50351-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"