After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse BCL11A Informações sobre o produto de clone de cDNA
Tamanho de cDNA:576bp
Descrição de cDNA:Full length Clone DNA of Mus musculus B cell CLL/lymphoma 11A (zinc finger protein) with N terminal His tag.
Sinónimo de gene:Evi9, Ctip1, Evi9a, Evi9b, Evi9c, BCL-11A, mKIAA1809, 2810047E18Rik, D930021L15Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52551-ACG$225
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52551-ACR$225
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52551-ANG$225
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52551-ANR$225
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52551-CF$195
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52551-CH$195
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52551-CM$195
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52551-CY$195
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de expressão)MG52551-G$75
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52551-NF$195
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52551-NH$195
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52551-NM$195
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52551-NY$195
Ratazanao Ctip1/BCL11A clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52551-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52551-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.