Encomenda rápida

Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse BCHE Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1812bp
Descrição de cDNA:Full length Clone DNA of Mus musculus butyrylcholinesterase with C terminal Flag tag.
Sinónimo de gene:MGC107651, C730038G20Rik, Bche
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50418-ACG$245
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50418-ACR$245
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50418-CF$215
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50418-CH$215
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50418-CM$215
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50418-CY$215
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de expressão)MG50418-M$75
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50418-NF$215
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50418-NH$215
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50418-NM$215
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50418-NY$215
Ratazanao BCHE/Butyrylcholinesterase clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50418-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Butyrylcholinesterase (BCHE), also known as cholinesterase or BuChE, is an enzyme defined as "pseudo" or "non-neuronal" cholinesterase. Butyrylcholinesterase (BCHE) is widely distributed in the nervous system as well as blood plasma. It is constitutively similar to the neuronal acetylcholinesterase, and is a non-specific cholinesterase which hydrolyses many different choline esters. Butyrylcholinesterase (BCHE) is a glycoprotein of 4 identical subunits, that were arranged as a dimer of dimers with each dimer composed of two identical subunits joined by interchain disulfide bonds. Butyrylcholinesterase (BCHE) behaves principally similar to the true enzyme and thus can play a similar role in nerve conduction, although it participates probably only in relatively slow conductive processes and could be involved in other nervous system functions and in neurodegenerative diseases. It can hydrolyze toxic esters such as cocaine or scavenge organophosphorus pesticides and nerve agents. Purified human serum cholinesterase combines in its active surface an anionic and an esteratic site, similar to true cholinesterase. It has been demonstrated that butyrylcholinesterase (BCHE) may have a greater role in cholinergic transmission than previously surmised, making BChE inhibition an important therapeutic goal in Alzheimer's disease.

  • Lockridge O. (1988) Structure of human serum cholinesterase. Bio Essays. 9(4):125-8.
  • Mesulam M, et al. (2002) Widely Spread Butyrylcholinesterase Can Hydrolyze Acetylcholine in the Normal and Alzheimer Brain. Neurobiology of Disease. 9(1): 88-93.
  • Nicolet Y, et al. (2003) Crystal Structure of Human Butyrylcholinesterase and of Its Complexes with Substrate and Products. The Journal of Biological Chemistry. 278: 41141-7.
  • Size / Price
    Catálogo: MG50418-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.