After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TNFRSF13C Informações sobre o produto de clone de cDNA
Tamanho de cDNA:528bp
Descrição de cDNA:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 13c with C terminal Myc tag.
Sinónimo de gene:Bcmd, Baffr, Bcmd1, BAFF-R, Bcmd-1, Lvis22, MGC123890, MGC123891, 2010006P15Rik, Tnfrsf13c
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50353-ACG$225
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50353-ACR$225
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50353-CF$195
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50353-CH$195
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50353-CM$195
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50353-CY$195
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50353-M$75
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50353-NF$195
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50353-NH$195
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50353-NM$195
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50353-NY$195
Ratazanao BAFFR / TNFRSF13C / CD268 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50353-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) also known as B-cell-activating factor receptor (BAFFR) and CD268 antigen, is a member of the tumor necrosis factor receptor superfamily. A tumor necrosis factor receptor (TNFR), or death receptor, is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. It has been proposed that abnormally high levels of BAFFR/TNFRSF13C (CD268) may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells.

  • Ashkenazi A, et al. (1998) Death receptors: signaling and modulation. Science. 281(5381): 1305-8.
  • Losi CG, et al. (2005) Mutational analysis of human BAFF receptor TNFRSF13C (BAFF-R) in patients with common variable immunodeficiency. J Clin Immunol. 25(5): 496-502.
  • Hentges KE, et al. (2002) Tnfrsf13c (Baffr) is mis-expressed in tumors with murine leukemia virus insertions at Lvis22. Genomics. 80(2): 204-12.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.