Encomenda rápida

Text Size:AAA

Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse BACE2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1545bp
Descrição de cDNA:Full length Clone DNA of Mus musculus beta-site APP-cleaving enzyme 2 with C terminal Flag tag.
Sinónimo de gene:ARP1, BAE2, DRAP, AEPLC, ALP56, ASP21, CDA13, CEAP1, AI850424, 1110059C24Rik, Bace2
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51031-ACG$245
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51031-ACR$245
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51031-CF$215
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51031-CH$215
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51031-CM$215
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51031-CY$215
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51031-G$75
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51031-NF$215
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51031-NH$215
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51031-NM$215
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51031-NY$215
Ratazanao BACE2 / Beta secretase 2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51031-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

BACE2, also known as beta secretase 2, belongs to the peptidase A1 family. It is a protease known to be an important enzyme involved in the cellular pathways. BACE2 has been shown to interact with GGA1 and GGA2. It is the major β-secretase in vivo. BACE2 is located on chromosome 21 and may play a role in alzheimer's disease pathogenesis in down syndrome(DS). Overexpression of BACE2 by lentivirus markedly reduced amyloid β protein production in primary neurons. Despite an extra copy of the BACE2 gene in DS and the increase of its transcription, BACE2 protein levels are unchanged.

  • Hussain I, et al. (2001) Prodomain processing of Asp1 (BACE2) is autocatalytic. J Biol Chem. 276(26):23322-8.
  • Solans A, et al. (2000) A new aspartyl protease on 21q22.3, BACE2, is highly similar to Alzheimer's amyloid precursor protein beta-secretase. Cytogenet Cell Genet. 89(3-4): 177-84.
  • Hussain I, et al. (2001) ASP1 (BACE2) cleaves the amyloid precursor protein at the beta-secretase site. Mol Cell Neurosci. 16(5):609-19.
  • Size / Price
    Catálogo: MG51031-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.