After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao ICOSL/ICOS ligand/B7-h2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse ICOSLG Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_015790.3
Tamanho de cDNA:969bp
Descrição de cDNA:Full length Clone DNA of Mus musculus icos ligand with N terminal Myc tag.
Sinónimo de gene:B7h, GI50, GL50, B7-H2, LICOS, B7RP-1, GL50-B, ICOS-L, Icoslg, Ly115l, AU044799, BG071784, KIAA0653, mKIAA0653, Icosl
Espécie:Mouse
Vetor:pCMV3-SP-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao ICOSL/ICOS ligand/B7-h2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Product nameProduct name
Fundo

Inducible co-stimulator ligand (ICOSL), also known as B7-H2, is a member of the B7 family of co-stimulatory molecules related to B7-1 and B7-2. It is a transmembrane glycoprotein with extracellular IgV and IgC domains, and binds to ICOS on activated T cells, thus delivers a positive costimulatory signal for optimal T cell function. The structural features of ICOSL are crucial for its costimulatory function. Present study shows that ICOSL displays a marked oligomerization potential, resembling more like B7-1 than B7-2. B7-H2-dependent signaling may play an active role in a proliferative response rather than in cytokine and chemokine production. The CD28/B7 and ICOS/B7-H2 pathways are both critical for costimulating T cell immune responses. Deficiency in either pathway results in defective T cell activation, cytokine production and germinal center formation.

Referências
  • Flesch IE. (2002) Inducible costimulator-ligand (ICOS-L). J Biol Regul Homeost Agents. 16(3): 217-9.
  • Kajiwara K, et al. (2009) Expression and function of the inducible costimulator ligand B7-H2 in human airway smooth muscle cells. Allergol Int. 58(4): 573-83.
  • Wong SC, et al. (2009) Functional hierarchy and relative contribution of the CD28/B7 and ICOS/B7-H2 costimulatory pathways to T cell-mediated delayed-type hypersensitivity. Cell Immunol. 256(1-2): 64-71.
  • Size / Price
    Catálogo: MG50190-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"