SPG3A cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50784-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SPG3A Reagents

CRO Services

Product recommended


All SPG3A Reagents

SPG3A cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1677 bp
Description
Full length Clone DNA of Mouse atlastin GTPase 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPG3A cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

4930435M24Rik cDNA ORF Clone, Mouse;Adfsp cDNA ORF Clone, Mouse;Fsp1 cDNA ORF Clone, Mouse;Spg3 cDNA ORF Clone, Mouse;Spg3a cDNA ORF Clone, Mouse

SPG3A Background Information

Atlastin-1, also known as Spastic paraplegia 3 protein A, Guanine nucleotide-binding protein 3, GTP-binding protein 3, GBP3, ATL1 and SPG3A, is a multi-pass membrane protein which belongs to the GBP family and atlastin subfamily. ATL1 / SPG3A is expressed predominantly in the adult and fetal central nervous system. Expression of ATL1 / SPG3A in adult brain is at least 5-fold higher than in other tissues. ATL1 / SPG3A is detected predominantly in pyramidal neurons in the cerebral cortex and the hippocampus of the brain. ATL1 / SPG3A is also expressed in upper and lower motor neurons (at protein level). A distinguishing feature of ATL1 / SPG3A is its frequent early onset, raising the possibility that developmental abnormalities may be involved in its pathogenesis. Missense SPG3A mutant atlastin-1 proteins have impaired GTPase activity and may act in a dominant-negative, loss-of-function manner by forming mixed oligomers with wild-type atlastin-1. Defects in ATL1 / SPG3A are the cause of spastic paraplegia autosomal dominant type 3 (SPG3), also known as Strumpell-Lorrain syndrome. Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs.
Full Name
atlastin GTPase 1
References
  • Zhao X., et al.,(2001), Mutations in a newly identified GTPase gene cause autosomal dominant hereditary spastic paraplegia. Nat. Genet. 29:326-331.
  • Luan Z., et al., (2002), A novel GTP-binding protein hGBP3 interacts with NIK/HGK.FEBS Lett. 530:233-238.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • SPG3A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SPG3A cDNA ORF Clone in Cloning Vector, Mouse MG50784-G
    SPG3A cDNA ORF Clone, Mouse, untagged MG50784-UT
    SPG3A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50784-ACGLN
    SPG3A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50784-ACG
    SPG3A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50784-ACR
    SPG3A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50784-CF
    SPG3A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50784-NF
    SPG3A cDNA ORF Clone, Mouse, C-His tag MG50784-CH
    SPG3A cDNA ORF Clone, Mouse, N-His tag MG50784-NH
    SPG3A cDNA ORF Clone, Mouse, C-HA tag MG50784-CY
    SPG3A cDNA ORF Clone, Mouse, N-HA tag MG50784-NY
    SPG3A cDNA ORF Clone, Mouse, C-Myc tag MG50784-CM
    SPG3A qPCR Primer Pairs, Mouse MP200758

    SPG3A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SPG3A cDNA ORF Clone in Cloning Vector, Human HG10523-M
    SPG3A cDNA ORF Clone, Human, untagged HG10523-UT
    SPG3A cDNA ORF Clone, Human, C-GFPSpark® tag HG10523-ACG
    SPG3A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10523-ACGLN
    SPG3A cDNA ORF Clone, Human, N-GFPSpark® tag HG10523-ANG
    SPG3A cDNA ORF Clone, Human, C-OFPSpark® tag HG10523-ACR
    SPG3A cDNA ORF Clone, Human, N-OFPSpark® tag HG10523-ANR
    SPG3A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10523-CF
    SPG3A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10523-NF
    SPG3A cDNA ORF Clone, Human, C-His tag HG10523-CH
    SPG3A cDNA ORF Clone, Human, N-His tag HG10523-NH
    SPG3A cDNA ORF Clone, Human, C-HA tag HG10523-CY
    SPG3A cDNA ORF Clone, Human, N-HA tag HG10523-NY
    SPG3A cDNA ORF Clone, Human, C-Myc tag HG10523-CM
    SPG3A cDNA ORF Clone, Human, N-Myc tag HG10523-NM
    SPG3A qPCR Primer Pairs, Human HP100540
    info info
    添加购物车成功! 添加购物车失败!