Encomenda rápida

Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse ARPC2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:903bp
Descrição de cDNA:Full length Clone DNA of Mus musculus actin related protein 2/3 complex, subunit 2 with N terminal His tag.
Sinónimo de gene:34kDa, p34-Arc, MGC141099, 2210023N03Rik, Arpc2
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50745-ACG$225
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50745-ACR$225
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG50745-ANG$225
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG50745-ANR$225
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50745-CF$195
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50745-CH$195
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50745-CM$195
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50745-CY$195
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50745-G$75
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50745-NF$195
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50745-NH$195
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50745-NM$195
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50745-NY$195
Ratazanao ARPC2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50745-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG50745-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.