Encomenda rápida

Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato ARF6 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:528bp
Descrição de cDNA:Full length Clone DNA of Mus musculus ADP-ribosylation factor 6 with N terminal His tag.
Sinónimo de gene:AI788669, AW496366
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
( We provide with ARF6 qPCR primers for gene expression analysis, MP201845 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51972-ACG$225
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51972-ACR$225
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51972-ANG$225
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51972-ANR$225
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51972-CF$195
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51972-CH$195
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51972-CM$195
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51972-CY$195
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51972-G$75
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51972-NF$195
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51972-NH$195
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51972-NM$195
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51972-NY$195
Ratazanao Arf6/ADP-ribosylation factor 6 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51972-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51972-NH
Preço de catálogo: 
Preço:      (You Save: )
Acrescentar a carrinhoBulk Discount Requiry
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.