Encomenda rápida

Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato APLP1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_007467.3
    Tamanho de cDNA:1965bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus amyloid beta (A4) precursor-like protein 1 with C terminal His tag.
    Sinónimo de gene:Aplp1
    Espécie:Mouse
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with APLP1 qPCR primers for gene expression analysis, MP201603 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51730-ACG$245
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51730-ACR$245
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51730-CF$215
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51730-CH$215
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51730-CM$215
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51730-CY$215
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51730-G$75
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51730-NF$215
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51730-NH$215
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51730-NM$215
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51730-NY$215
    Ratazanao APLP1 / Amyloid-like Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51730-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    APLP1, also known as amyloid-like protein 1, is a member of the highly conserved amyloid precursor protein gene family. APLP1 is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. APLP1, together with APLP2, are important modulators of glucose. APLP1 may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. APLP1 also is a mammalian homologue of amyloid precursor protein (APP). APP is a type I membrane protein that is genetically linked to Alzheimer's disease.

    Referências
  • Wasco W. et al., 1993, Genomics. 15 (1): 237-9.
  • Needham BE. et al., 2008, J Pathol. 215 (2): 155-63.
  • Bayer TA. et al., 2000, Mol Psychiatry. 4 (6): 524-8.
  • Lee S. et al., 2011, Biochemistry. 50 (24): 5453-64.
  • Size / Price
    Catálogo: MG51730-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"